Answer:
5′ ATGGTTCCATC 3′
3′ TACCAAGGTAG 5′ is it's complementary DANA strand. But for mRNA transcription from DNA only the strand with polarity from 3′→5′ act as a template & is referred to as template strand, thus the mRNA strand will be :
5′ AUGGUUCCAUC 3′ in mRNA thymine nucleaotide isn't existing rather uracil replaces it & binds with Adenine just lyk thymine.
P.S. when 5′-> 3′ DNA sequence is given, RNA has same sequence of nucleaotide as given DNA except uracil in place of thymine.
Explanation:
According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.